Cerebrovascular amyloidosis associated with Alzheimer's disease has been isolated and by high performance liquid chromatography.[1]
Timeline
Purified and characterized the cerebral amyloid protein that forms the plaque core in Alzheimer disease and in aged individuals with Down syndrome.[2]
Atomic force microscopy was used to follow amyloid fibril formation in vitro by the Abeta variants Abeta1-40 and Abeta1-42.[3]
High-affinity RNA aptamers against the betaA4(1-40) were isolated from a combinatorial library of approximately 10(15) different molecules.[6]
Description
Using the preincubated dimer model of E22P–Aβ42, which dimerized via a linker located at Val-40, as the target of in vitro selection, Murakami and his colleague obtained RNA aptamers with higher affinity toward PFs derived from a toxic Aβ42 dimer than toward fibrils produced from WT Aβ42 or from a toxic, conformationally constrained Aβ42 variant, E22P–Aβ42[11].
SELEX
Using the preincubated dimer model of E22P–Aβ42, which dimerized via a linker located at Val-40, as the target of in vitro selection, Murakami and his colleague obtained RNA aptamers with higher affinity toward PFs derived from a toxic Aβ42 dimer than toward fibrils produced from WT Aβ42 or from a toxic, conformationally constrained Aβ42 variant, E22P–Aβ42[11].
Structure
The 2D structure of the figures is based on the article by ribodraw tool to draw[11].
E22P-AbD43: GGGACGAAGACCAACUGAACUUUGUGGUGGCGGCUACUCGUGUUCUUUUGACUUUGUCCGUGCUGCCACCUUACUUC
E22P-AbD4: GGGACGAAGACCAACUGAACUUUAGGAGGGGGCAUUUGGACCAGUUUGUGUCUUUGUCCGUGCUGCCACCUUACUUC
E22P-AbD31: GGGACGAAGACCAACUGAACUUUUGGGUGGUAACAGGUAGCUCCGGUUGUCCUUUGUCCGUGCUGCCACCUUACUUC
Ligand information
SELEX ligand
Amyloid-beta peptides are lipophilic metal chelators with metal-reducing activity. Bind transient metals such as copper, zinc and iron. In vitro, can reduce Cu2+ and Fe3+ to Cu+ and Fe2+, respectively. Amyloid-beta protein 42 is a more effective reductant than amyloid-beta protein 40. Amyloid-beta peptides bind to lipoproteins and apolipoproteins E and J in the CSF and to HDL particles in plasma, inhibiting metal-catalyzed oxidation of lipoproteins.-----from Pfam
| Name | Uniprot ID | Pfam | MW | Amino acids sequences | PDB | Gene ID |
|---|---|---|---|---|---|---|
| Amyloid-beta precursor protein | P05067 | Q8TDB1 | 86.94 kDa | MLPGLALLLLAAWTARALEVPTDGNAGLLAEPQIAMFCGRLNMHMNVQNGKWDSDPSGTKTCIDTKEGILQYCQEVYPELQITNVVEANQPVTIQNWCKRGRKQCKTHPHFVIPYRCLVGEFVSDALLVPDKCKFLHQERMDVCETHLHWHTVAKETCSEKSTNLHDYGMLLPCGIDKFRGVEFVCCPLAEESDNVDSADAEEDDSDVWWGGADTDYADGSEDKVVEVAEEEEVAEVEEEEADDDEDDEDGDEVEEEAEEPYEEATERTTSIATTTTTTTESVEEVVREVCSEQAETGPCRAMISRWYFDVTEGKCAPFFYGGCGGNRNNFDTEEYCMAVCGSAMSQSLLKTTQEPLARDPVKLPTTAASTPDAVDKYLETPGDENEHAHFQKAKERLEAKHRERMSQVMREWEEAERQAKNLPKADKKAVIQHFQEKVESLEQEAANERQQLVETHMARVEAMLNDRRRLALENYITALQAVPPRPRHVFNMLKKYVRAEQKDRQHTLKHFEHVRMVDPKKAAQIRSQVMTHLRVIYERMNQSLSLLYNVPAVAEEIQDEVDELLQKEQNYSDDVLANMISEPRISYGNDALMPSLTETKTTVELLPVNGEFSLDDLQPWHSFGADSVPANTENEVEPVDARPAADRGLTTRPGSGLTNIKTEEISEVKMDAEFRHDSGYEVHHQKLVFFAEDVGSNKGAIIGLMVGGVVIATVIVITLVMLKKKQYTSIHHGVVEVDAAVTPEERHLSKMQQNGYENPTYKFFEQMQN | 1AAP | AK294534.1 |
| Name | Sequence | Ligand | Affinity |
|---|---|---|---|
| E22P-AbD4 | GGGACGAAGACCAACUGAACUUUAGGAGGGGGCAUUUGGACCAGUUUGUGUCUUUGUCCGUGCUGCCACCUUACUUC | Aβ42 toxic dimer | NA |
| E22P-AbD31 | GGGACGAAGACCAACUGAACUUUUGGGUGGUAACAGGUAGCUCCGGUUGUCCUUUGUCCGUGCUGCCACCUUACUUC | Aβ42 toxic dimer | NA |
| E22P-AbD43 | GGGACGAAGACCAACUGAACUUUGUGGUGGCGGCUACUCGUGUUCUUUUGACUUUGUCCGUGCUGCCACCUUACUUC | Aβ42 toxic dimer | 20 ± 6.0 nM |
Similar compound
We used the Dail server website to compare the structural similarities of ligand proteins, and chose the top 10 in terms of similarity for presentation. The Dali server is a network service for comparing protein structures in 3D. Dali compares them against those in the Protein Data Bank (PDB). Z-score is a standard score that is converted from an original score. The list of neighbours is sorted by Z-score. Similarities with a Z-score lower than 2 are spurious. RMSD(Root Mean Square Deviation) value is used to measure the degree to which atoms deviate from the alignment position.
| Named | CAS | Pubchem CID | Structure |
|---|---|---|---|
| 1T8L-B | 0.9 | 56 | Chymotrypsin A |
| 5C67-C | 0.4 | 53 | Trypsin-3 |
| 1ZR0-B | 0.7 | 56 | Cationic trypsin |
| 2ODY-F | 0.5 | 55 | Prothrombin (ec 3.4.21.5) |
| 1BIK-A | 0.6 | 53 | Bikunin |
| 3M7Q-B | 1.2 | 56 | Cationic trypsin |
| 3AUE-C | 1.0 | 56 | Bovine pancreatic trypsin inhibitor |
| 4BQD-A | 0.7 | 56 | Tissue factor pathway inhibitor (lipoprotein-asso |
| 5H7V-A | 0.9 | 53 | Kunitz-type protease inhibitor 1 |
| 4NTW-B | 1.5 | 56 | Acid-sensing ion channel 1 |
References
[1] Alzheimer’s disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein.Glennera, G. G., & Wong, C. W.
Biochemical and biophysical research communications, 120(3), 885–890. (1984)
[2] Amyloid plaque core protein in Alzheimer disease and Down syndrome.
Masters, C. L., Simms, G., Weinman, N. A., Multhaup, G., McDonald, B. L., & Beyreuther, K.
Proceedings of the National Academy of Sciences of the United States of America, 82(12), 4245–4249. (1985)
[3] Observation of metastable Aβ amyloid protofibrils by atomic force microscopy.
Harper, J. D., Wong, S. S., Lieber, C. M., & Lansbury, P. T.
Chemistry & biology, 4(2), 119–125. (1997)
[4] Amyloid beta-protein fibrillogenesis. Detection of a protofibrillar intermediate.
Walsh, D. M., Lomakin, A., Benedek, G. B., Condron, M. M., & Teplow, D. B.
The Journal of biological chemistry, 272(35), 22364–22372. (1997)
[5] Diffusible, nonfibrillar ligands derived from Abeta1-42 are potent central nervous system neurotoxins.
Lambert, M. P., Barlow, A. K., Chromy, B. A., Edwards, C., Freed, R., Liosatos, M., Morgan, T. E., Rozovsky, I., Trommer, B., Viola, K. L., Wals, P., Zhang, C., Finch, C. E., Krafft, G. A., & Klein, W. L.
Proceedings of the National Academy of Sciences of the United States of America, 95(11), 6448–6453. (1998)
[6] Selection of RNA aptamers to the Alzheimer's disease amyloid peptide.
Ylera, F., Lurz, R., Erdmann, V. A., & Fürste, J. P.
Biochemical and biophysical research communications, 290(5), 1583–1588. (2002)
[7] Spherical aggregates of beta-amyloid (amylospheroid) show high neurotoxicity and activate tau protein kinase I/glycogen synthase kinase-3beta.
Hoshi, M., Sato, M., Matsumoto, S., Noguchi, A., Yasutake, K., Yoshida, N., & Sato, K.
Proceedings of the National Academy of Sciences of the United States of America, 100(11), 6370–6375. (2003)
[8] Soluble protein oligomers in neurodegeneration: lessons from the Alzheimer's amyloid beta-peptide.
Haass, C., & Selkoe, D. J.
Nature reviews. Molecular cell biology, 8(2), 101–112. (2007)
[9] Amyloid β-protein assembly and Alzheimer disease.
Roychaudhuri, R., Yang, M., Hoshi, M. M., & Teplow, D. B.
The Journal of biological chemistry, 284(8), 4749–4753. (2009)
[10] High-speed atomic force microscopy reveals structural dynamics of amyloid β1-42 aggregates.
Watanabe-Nakayama, T., Ono, K., Itami, M., Takahashi, R., Teplow, D. B., & Yamada, M.
Proceedings of the National Academy of Sciences of the United States of America, 113(21), 5835–5840. (2016)
[11] An RNA aptamer with potent affinity for a toxic dimer of amyloid β42 has potential utility for histochemical studies of Alzheimer's disease.
Murakami, K., Obata, Y., Sekikawa, A., Ueda, H., Izuo, N., Awano, T., Takabe, K., Shimizu, T., & Irie, K.
The Journal of biological chemistry, 295(15), 4870–4880. (2020)