Mutational analysis revealed that both the positive charge and the size of the amino acid side chain located at the Q/R site control the divalent permeability of homomeric channels. Coexpression of Q/R site arginine- and glutamine-containing subunits generates cells with varying divalent permeabilities depending on the amounts of expression vectors used for cell transfection.[1]
Timeline
The presence of two major populations of AMPA receptor complexes: those made up of GluR1 and GluR2 and those made up of GluR2 and GluR3. Very few complexes contained both GluR1 and GluR3, whereas approximately 8% of the total AMPA receptor complexes was homomeric GluR1.[2]
AMPAR assembly and subunit stoichiometry are determined by RNA editing in the pore loop. They also demonstrate that editing at the GluR2 Q/R site regulates AMPAR assembly at the step of tetramerization.[6]
Selected a group of RNA aptamers against the recombinant GluR2Qflip AMPA receptor transiently expressed in HEK-293 (human embryonic kidney) cells using the systematic evolution of ligands by exponential enrichment (SELEX).[7]
Reported the identification of an RNA inhibitor or aptamer by an in vitro evolution approach. Using a laser-pulse photolysis technique, we further characterized the mechanism of inhibition of this aptamer on the AMPA receptor channel-opening rate process in the microsecond-to-millisecond time domain.[8]
Report the use of an in vitro evolution approach involving systematic evolution of ligands by exponential enrichment with a single AMPA receptor target (i.e. GluA1/2R) to isolate RNA aptamers that can potentially inhibit both AMPA and kainate receptors.[11]
Description
In 2007, Huang and his collegeague used the systematic evolution of ligands by exponential enrichment (SELEX) to selecte a group of RNA aptamers against the recombinant GluR2Qflip AMPA receptor transiently expressed in HEK-293 (human embryonic kidney) cells. In 2017, J. Jaremko and his colleagues used homologous binding and whole-cell recording assays to find an RNA aptamer most likely binds to the receptor’s regulatory site and in- hibits it noncompetitively[8,12].
SELEX
In 2017, To select RNA aptamers, J. Jaremko and his colleague used SELEX (31, 32), which involves multiple cycles or rounds. Each round consists of RNA-receptor binding, RNA elution, RT-PCR amplification, followed by enzymatic transcription from the DNA library to regenerate a new RNA library or pool[12].
Structure
The 2D structure of the figures is based on the article by ribodraw tool to draw[12].
5'-GGGAGAAUUCAACUGCCAUCUAGGCAGAUCACGAAAAAGCGGAAUUGAGGUACCCAAGAGCUAAAAAAAGACAUCCAGUACUACAAGCUUCUGGACUCGGU-3'
Ligand information
SELEX ligand
The α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (also known as AMPA receptor, AMPAR, or quisqualate receptor) is an ionotropic transmembrane receptor for glutamate (iGluR) and predominantly Na+ ion channel that mediates fast synaptic transmission in the central nervous system (CNS).
Kainate receptors, or kainic acid receptors (KARs), are ionotropic receptors that respond to the neurotransmitter glutamate. They were first identified as a distinct receptor type through their selective activation by the agonist kainate, a drug first isolated from the algae Digenea simplex. They have been traditionally classified as a non-NMDA-type receptor, along with the AMPA receptor.-----from WIKI
| Name | Uniprot ID | Pfam | MW | Amino acids sequences | PDB | Gene ID |
|---|---|---|---|---|---|---|
| AMPA receptor and kainate receptor |
P42261 P39086 |
CD13724 | 101.506 kDa | MQHIFAFFCTGFLGAVVGANFPNNIQIGGLFPNQQSQEHAAFRFALSQLTEPPKLLPQIDIVNISDSFEMTYRFCSQFSKGVYAIFGFYERRTVNMLTSFCGALHVCFITPSFPVDTSNQFVLQLRPELQDALISIIDHYKWQKFVYIYDADRGLSVLQKVLDTAAEKNWQVTAVNILTTTEEGYRMLFQDLEKKKERLVVVDCESERLNAILGQIIKLEKNGIGYHYILANLGFMDIDLNKFKESGANVTGFQLVNYTDTIPAKIMQQWKNSDARDHTRVDWKRPKYTSALTYDGVKVMAEAFQSLRRQRIDISRRGNAGDCLANPAVPWGQGIDIQRALQQVRFEGLTGNVQFNEKGRRTNYTLHVIEMKHDGIRKIGYWNEDDKFVPAATDAQAGGDNSSVQNRTYIVTTILEDPYVMLKKNANQFEGNDRYEGYCVELAAEIAKHVGYSYRLEIVSDGKYGARDPDTKAWNGMVGELVYGRADVAVAPLTITLVREEVIDFSKPFMSLGISIMIKKPQKSKPGVFSFLDPLAYEIWMCIVFAYIGVSVVLFLVSRFSPYEWHSEEFEEGRDQTTSDQSNEFGIFNSLWFSLGAFMQQGCDISPRSLSGRIVGGVWWFFTLIIISSYTANLAAFLTVERMVSPIESAEDLAKQTEIAYGTLEAGSTKEFFRRSKIAVFEKMWTYMKSAEPSVFVRTTEEGMIRVRKSKGKYAYLLESTMNEYIEQRKPCDTMKVGGNLDSKGYGIATPKGSALRNPVNLAVLKLNEQGLLDKLKNKWWYDKGECGSGGGDSKDKTSALSLSNVAGVFYILIGGLGLAMLVALIEFCYKSRSESKRMKGFCLIPQQSINEAIRTSTLPRNSGAGASSGGSGENGRVVSHDFPKSMQSIPCMSHSSGMPLGATGL | 1US4 | L19058.1 |
J. Jaremko and his colleague prepared 32P-labeled AB9s and ran a homologous binding assay with the GluA1/2R lipid membrane. Because AB9s exhibited full inhibitory activity against GluA1/2R to determine the binding affinity of AB9s, the shorter aptamer.Using the same homologous binding assay, they carried out the binding experiment with 32P-labeled AB9 and GluA1/2R lipid membrane[12].
| Name | Sequence | Ligand | Affinity |
|---|---|---|---|
| AB9 | GGGAGAAUUCAACUGCCAUCUAGGCAGAUCACGAAAAAGCGGAAUUGAGGUACCCAAGAGCUAAAAAAAGACAUCCAGUACUACAAGCUUCUGGACUCGGU | AMPA and kainate receptors | 4.5 μM |
| AB9s | GGGUGCCAUCUAGGCAGAUCACGAAAAAGCGAAAGCUAAAAAAAGACAUCCACCC | AMPA and kainate receptors | 4.7 μM |
Similar compound
We used the Dail server website to compare the structural similarities of ligand proteins, and chose the top 10 in terms of similarity for presentation. The Dali server is a network service for comparing protein structures in 3D. Dali compares them against those in the Protein Data Bank (PDB). Z-score is a standard score that is converted from an original score. The list of neighbours is sorted by Z-score. Similarities with a Z-score lower than 2 are spurious. RMSD(Root Mean Square Deviation) value is used to measure the degree to which atoms deviate from the alignment position.
| Named | CAS | Pubchem CID | Structure |
|---|---|---|---|
| 4DDD-A | 36.3 | 2.2 | Immunogenic protein |
| 3QSL-B | 16.1 | 3.0 | Putative exported protein |
| 6SSY-A | 15.9 | 3.0 | Taurine-binding periplasmic protein |
| 4ESW-A | 15.8 | 2.9 | Pyrimidine biosynthesis enzyme thi13 |
| 7S6G-A | 15.5 | 3.2 | Phosphonate abc type transporter/ substrate bindi |
| 4NMY-A | 14.9 | 3.2 | ABC-type transport system, extracellular solute-b |
| 8HKB-A | 14.8 | 3.6 | Periplasmic terephthalate binding protein (tbp) |
| 3UN6-A | 14.7 | 3.9 | ABC transporter substrate-binding protein |
| 3QK6-B | 14.7 | 2.9 | PHND, subunit of alkylphosphonate abc transporter |
| 6ESK-A | 14.6 | 2.9 | Putative periplasmic phosphite-binding-like prote |
| 7DM1-A | 14.3 | 3.2 | Phosphate-binding protein psts 1 |
References
[1] Divalent ion permeability of AMPA receptor channels is dominated by the edited form of a single subunit.Burnashev, N., Monyer, H., Seeburg, P. H., & Sakmann, B.
Neuron 8, 189–198. (1992)
[2] Evidence for multiple AMPA receptor complexes in hippocampal CA1/CA2 neurons.
Wenthold, R. J., Petralia, R. S., Blahos, J., II, & Niedzielski, A. S.
J. Neurosci. 16, 1982–1989. (1996)
[3] The role of RNA editing in controlling glutamate receptor channel properties.
Seeburg, P. H.
J. Neurochem. 66, 1–5. (1996)
[4] Single-channel properties of recombinant AMPA receptors depend on RNA editing, splice variation, and subunit composition.
Swanson, G. T., Kamboj, S. K., & Cull-Candy, S. G.
J. Neurosci. 17, 58–69. (1997)
[5] Unequal expression of allelic kainate receptor GluR7 mRNAs in human brains.
Schiffer, H. H., Swanson, G. T., Masliah, E., & Heinemann, S. F.
J. Neurosci. 20, 9025–9033. (2000)
[6] AMPA receptor tetramerization is mediated by Q/R editing.
Greger, I. H., Khatri, L., Kong, X., & Ziff, E. B.
Neuron. 40, 763–774. (2003)
[7] RNA aptamers selected against the GluR2 glutamate receptor channel.
Huang, Z., Pei, W., Jayaseelan, S., Shi, H., & Niu, L.
Biochemistry, 46(44), 12648–12655. (2007)
[8] Potent and selective inhibition of the open-channel conformation of AMPA receptors by an RNA aptamer.
Huang, Z., Han, Y., Wang, C., & Niu, L.
Biochemistry, 49(27), 5790–5798. (2010)
[9] Potent and selective inhibition of a single alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor subunit by an RNA aptamer.
Park, J. S., Wang, C., Han, Y., Huang, Z., & Niu, L.
The Journal of biological chemistry, 286(17), 15608–15617. (2011)
[10] Chemically Modified, α-Amino-3-hydroxy-5-methyl-4-isoxazole (AMPA) Receptor RNA Aptamers Designed for in Vivo Use.
Huang, Z., Wen, W., Wu, A., & Niu, L.
ACS chemical neuroscience, 8(11), 2437–2445. (2017)
[11] Identification and characterization of RNA aptamers: A long aptamer blocks the AMPA receptor and a short aptamer blocks both AMPA and kainate receptors.
Jaremko, W. J., Huang, Z., Wen, W., Wu, A., Karl, N., & Niu, L.
The Journal of biological chemistry, 292(18), 7338–7347. (2017)
[12] RNA aptamers for AMPA receptors.
Huang, Z., & Niu, L.
Neuropharmacology, 199, 108761. (2021)