Description
In 1990, Andrew D. Ellington & Jack W. Szostak isolated RNA binding to some dyes through in vitro selection experiments, and named these RNA specifically binding as aptamers. Subpopulations of RNA molecules that bind specifically to a variety of organic dyes have been isolated from a population of random sequence RNA molecules. Started the earliest example of aptamer selection[1].
SELEX
Andrew D. Ellington & Jack W. Szostak used the in vitro selection system to isolate RNAs that bind to several dyes that appear to mimic metabolic cofactors. After the sixth round of selection, sequenced 17 clones from the CB(Cibacron Blue 3GA) pool, three of which were identical, and 14 clones from the B4(Reactive Blue 4) pool, all of which were different[1].
Structure
The sequence and secondary prediction structure of the aptamer will be shown here, here we used ribodraw to complete the figure. In addition, an analytical affinity column was run under isocratic conditions to determine an approximate dissociation constant (Kd) for the RNA-ligand interaction. The 2D structure of the left figure is based on the literature, and the right figure is based on the prediction results of the RNA fold website. We used the minimum free energy (MFE) structure[1].
Reactive Blue 4_B4-25 aptamer:
5'-GGGAGAAUUCCCGCGGCGUUGGCCCAGGAUAAUAGGACGAAAUCCGAAAAAUCCGUACCCAACAUAGAACCCCCCCAGCGCUCACACGGACGCCCCAUUACGGCUAACCGAACGCCUGCAGCCCGGGAAGCUU-3'
Cibacron Blue 3GA_CB-42 aptamer:
5'-GGGAGAAUUCCCGCGGCAGAAGCCCACCUGGCUUUGAACUCUAUGUUAUUGGGUGGGGGAAACUUAAGAAAACUACCACCCUUCAACAUUACCGCCCUUCAGCCUGCCAGCGCCCUGCAGCCCGGGAAGCUU-3'
|
|
|
Ligand information
SELEX ligand
Reactive Blue 4 (CAS# 13324-20-4) is an organic dye used in textiles. Reactive Blue 4 is water-soluble and a pollutant, and has been decolourized in water using microbial fuel cells, Dyes and metabolites.-----From MedChemExpressCibacron Blue 3G-A is an anthraquinone dye, inhibits the R46 β-lactamase with a Ki value of 1.2 uM.-----From MedChemExpress
| Name | Molecular Formula | MW | CAS | Solubility | MedChemExpress |
|---|---|---|---|---|---|
| Reactive Blue 4 | C23H14Cl2N6O8S2 | 637.4 g/mol | 13324-20-4 | 80g/L(at 20°C, water) | HY-125815 |
| Cibacron Blue 3GA | C29H20ClN7O11S3 | 774.16 g/mol | 84166-13-2 | 62.5g/L(in DMSO) | HY-129042 |
Similar compound
We screened the compounds with great similarity to by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available, we will supplement them with Pubchem CID. For another compound, we used a similar compound query method from the PubChem database.
| Source ligand | Zinc_id | Named | CAS | pubchem CID | Structure |
|---|---|---|---|---|---|
| Reactive Blue 4 | ZINC000066076201 | Vilmafix Blue A-R | NA | 167524 | |
| Reactive Blue 4 | ZINC000027328433 | PSB-10211 | NA | 53308119 | |
| Reactive Blue 4 | ZINC000049888955 | 3-[(4-Amino-9,10-dioxo-3-sulfoanthracen-1-yl)amino]-5-[(4,6-dichloro-1,3,5-triazin-2-yl)amino]benzoic acid | NA | 25124828 | |
| Reactive Blue 4 | ZINC000049899400 | 1-Amino-4-[4-[(4-chloro-6-methoxy-1,3,5-triazin-2-yl)amino]-3-sulfoanilino]-9,10-dioxoanthracene-2-sulfonic acid | NA | 25123183 | |
| Reactive Blue 4 | ZINC000066099004 | 1-amino-4-[3-[(4,6-dioxo-1H-1,3,5-triazin-2-yl)amino]-4-sulfoanilino]-9,10-dioxoanthracene-2-sulfonic acid | NA | 53319011 | |
| Cibacron Blue 3GA | not in ZINC | Reactive Blue 2 | 79241-87-5 | 656725 | |
| Cibacron Blue 3GA | not in ZINC | Reactive Blue 5 | 16823-51-1 | 85599 | |
| Cibacron Blue 3GA | not in ZINC | Azure KX | 4499-01-8 | 78253 | |
| Cibacron Blue 3GA | not in ZINC | Reactive Blue 2 | NA | 9875920 | |
| Cibacron Blue 3GA | not in ZINC | PSB-10211 | NA | 53308119 |
References
[1] In vitro selection of RNA molecules that bind specific ligands.Ellington, A. D., & Szostak, J. W.
Nature, 346(6287), 818–822. (1990)