Description
In 2006, Gopinath, S. C., & Mizuno, H. selected an RNA aptamer by SELEX against bovine factor IX using an RNA pool containing 74-nucleotides randomized region. Selected RNA aptamer (Clone 5) could discriminate bovine factor IX effectively from human factor IX[1].
SELEX
In 2006, Gopinath, S. C., & Mizuno, H. selected an anti–bovine factor IX RNA aptamer with the starting RNA repertoire with randomized region over a 74-nucleotide. For each selection, the RNA pool and bovine factor IX were mixed and allowed to incubate for about 10 min, and then the bound oligonucleotide (Bovine factor IX–RNA complexes) are separated from the unbound oligonucleotides, either by filtration or xenoplate. Bound RNAs were recovered with hot 7 M urea and subsequently amplified by reverse transcription followed by PCR, and then the PCR products were transcribedin vitro. After five rounds of selection and amplification, about 54% of the RNA pool was bound to bovine IX[1].
Structure
The 2D structure of the figure is based on the article by ribodraw tool to draw[1].
5'-GGGAGCUCAGCCUUCACUGCCUACGCGGGCGUUUACGUAACGGCUUAUGGGGAGCUGAGCGCUUGACCGUGGUAGUGCUAAGCAGUAAACGAGGGCACCACGGUCGGAUCCAC-3'
Ligand information
SELEX ligand
Factor IX is a vitamin K-dependent plasma protein that participates in the intrinsic pathway of blood coagulation by converting factor X to its active form in the presence of Ca2+ ions, phospholipids, and factor VIIIa.-----from InterPro| Name | Uniprot ID | Pfam | MW | Amino acids sequences | PDB | Gene ID |
|---|---|---|---|---|---|---|
| Bovine factor IX | P00741 | IPR006369 | 5.64 kDa | YNSGKLEEFVRGNLERECKEEKCSFEEAREVFENTEKTTEFWKQYV | 1J34 | 2158 |
| Name | Sequence | Ligand | Affinity |
|---|---|---|---|
| Clone 5 | 5'-GGGAGCUCAGCCUUCACUGCCUACGCGGGCGUUUACGUAACGGCUUAUGGGGAGCUGAGCGCUUGACCGUGGUAGUGCUAAGCAGUAAACGAGGGCACCACGGUCGGAUCCAC-3' | Bovine factor IX | 10 nM |
Similar compound
We used the Dail server website to compare the structural similarities of ligand proteins, and chose the top 10 in terms of similarity for presentation. The Dali server is a network service for comparing protein structures in 3D. Dali compares them against those in the Protein Data Bank (PDB). Z-score is a standard score that is converted from an original score. The list of neighbours is sorted by Z-score. Similarities with a Z-score lower than 2 are spurious. RMSD(Root Mean Square Deviation) value is used to measure the degree to which atoms deviate from the alignment position.
| PDB | Z-socre | RMSD | Description |
|---|---|---|---|
| 1IOD-G | 8.9 | 0.8 | Coagulation factor x binding protein |
| 1NL1-A | 8.1 | 0.8 | Prothrombin |
| 1PFX-L | 7.2 | 1.6 | Factor ixa |
References
[1] An RNA aptamer that discriminates bovine factor IX from human factor IX.Gopinath, S. C., Balasundaresan, D., Akitomi, J., & Mizuno, H.
Journal of biochemistry, 140(5), 667–676. (2006)