Description
In 2019,Bachtiar, E. W. et al. selected RNA aptamers against yeast cells of C. albicans ATCC 10231 were developed using the systematic evolution of ligands by exponential enrichment (SELEX) technique. In addition, The aptamer Ca-apt-1 could inhibit biofilm and hyphal formation of C. albicans in vitro, as demonstrated using biofilm assays. This study shows that RNA aptamers could potentially be used in diagnostic and therapeutic applications for C. albicans-related disease in the future. In 2022, Bachtiar, E. W. et al. validated the use of Ca-apt-1, an RNA aptamer. Microscopic results demonstrated that Ca-apt-1 specifically recognized and immunostained C. albicans cells of rat tongue candidiasis, with a specificity comparable to that of PcAb. This study demonstrated that Ca-apt-1 can be used as a probe for immunostaining of fixed tissue sections for oral candidiasis diagnosis.[1,2].
SELEX
A library of RNAs containing 40‐nt randomized central sequences flanked by defined primer binding sites with the sequence of 5′‐GGGAGUCGACCGACCAGAA [N40] UAUGUGCGUCUACAUCUAGACUCAU‐3′ (84 nt) was generated as SELEX methods described with a calculated library complexity of 1 × 10^13 different RNA sequences. From the first to fifth rounds of the SELEX process, the components of the library that were enriched included specific and nonspecific binders. When the counterselection step was performed at the fifth round, the retention rate decreased gradually from the sixth to 10th rounds. They found that at the 11th round, the enrichment of the RNAs capable of binding to the target C. albicans increased significantly compared with the fifth round RNAs and the original library RNAs. Therefore, the PCR products from round 11 were cloned to characterize each aptamer. They do not exhibit any consensus sequences and are unique except for Ca-apt-1 and Ca-apt-12, which were identified four and two times during the screening, respectively. Their preferential retention during selection suggests that they might have high affinity toward the target cells.[1,2].
Structure
2D representation
The 2D structure of the figures is based on the article by ribodraw tool to draw. The predicted secondary structures of Ca-apt-1 and Ca-apt-12 with the lowest folding energy are shown. The nucleotides in the shaded area correspond to the randomized region of the aptamer.[1].
5'-GGGAGUCGACCGACCAGAACGAAAGACCAACGCAGCCAAACUGAAGCCCCAGUCGCCCCGUAUGUGCGUCUACAUCUAGACUCAU-3'
Ligand information
SELEX ligand
Candida albicans is an opportunistic pathogenic yeast that is a common member of the human gut flora. It can also survive outside the human body. It is detected in the gastrointestinal tract and mouth in 40–60% of healthy adults. It is usually a commensal organism, but it can become pathogenic in immunocompromised individuals under a variety of conditions. It is one of the few species of the genus Candida that cause the human infection candidiasis, which results from an overgrowth of the fungus.------From WiKi
| Name | GenBase Gene | GenBase Protein |
|---|---|---|
| Candida albicans | Gene Database | Protein Database |
Some isolated sequences bind to the affinity of the protein.
| Name | Sequence | Ligand | Affinity | Reference |
|---|---|---|---|---|
| Ca-apt-1 | 5'-GGGAGUCGACCGACCAGAACGAAAGACCAACGCAGCCAAACUGAAGCCCCAGUCGCCCCGUAUGUGCGUCUACAUCUAGACUCAU-3' | Candida albicans | Binding percentage: ≈8% | [1] |
| Ca-apt-12 | 5'-GGGAGUCGACCGACCAGAAAGCCCUCAACCCAGACACCCCCAACCUUCCUCGCCCCCCCUAUGUGCGUCUACAUCUAGACUCAU-3' | Candida albicans | Binding percentage: ≈10% |
References
[1] RNA aptamers selected against yeast cells inhibit Candida albicans biofilm formation in vitro..Bachtiar, B. M., Srisawat, C., & Bachtiar, E. W.
MicrobiologyOpen, 8(8), e00812. (2019)
[2] Validation of RNA Aptamer Probes to Image Candida albicans in Paraffin-Embedded Sections of Wistar Rat Tongue..
Bachtiar, B. M., Srisawat, C., Rahayu, R. P., Soedjodono, R. D., Prabandari, S. A., & Bachtiar, E. W.
European journal of dentistry, 16(3), 543–548. (2022)