Description
In 1997, Gold, L.et al. had been isolated mainly Cam-specific RNA aptamers to study RNA–antibiotic interactions. In 2011, Mehtaet al.engineered DNA aptamers that recognize Cam as their target, by conducting in vitro selections[1,2].
SELEX
Gold, L. et al. used SELEX to isolate two independent RNA populations with 70 or 80 random positions from random starting pools containing 10¹⁴-10¹⁵ sequences. After 12 cycles, 74 distinct sequences were identified among the 96 isolates sequenced, with 12 sequences found in pairs of identical or nearly identical isolates, 2 sequences found in three different isolates, and 2 sequences found in four different isolates. All other sequences were found only once[1].
Structure
The 2D structure of the figures is based on the prediction results of the RNA fold website by ribodraw tool to draw. 70Cam6 aptamer was named by Gold, L[1].
5'-GGGAAAAGCGAAUCAUACACAAGAAUGAAAAGGGCUGGCGAGACAUAUCCGCUGGGCAAUCAGAUUCGGAGCCGCACCACCCUCGAAGUAGACAGGGCAUAAGGUAUUUAAUUCCAUA-3'
Ligand information
SELEX ligand
Chloramphenicol is a broad spectrum antibiotic that is effective against a variety of susceptible and serious bacterial infections but is not frequently used because of its high risk of bone marrow toxicity.-----From Wiki
PubChem CID: a unique identifier for substances in the PubChem database.
CAS number: a global registry number for chemical substances.
Drugbank: a comprehensive database with detailed information on drugs and drug targets.
| Name | Molecular Formula | Molecular Weight | CAS | Solubility | PubChem | Drugbank ID |
|---|---|---|---|---|---|---|
| Chloramphenicol (Cam) | C11H12Cl2N2O5 | 323.13g/mol | 56-75-7 | 2500mg/L (at 25 °C) | 5959 | DB00446 |
Similar compound(s)
We screened the compounds with great similarity to by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available, we will supplement them with Pubchem CID. For another compound, we used a similar compound query method from the PubChem database.
ZINC ID: a compound identifier used by the ZINC database, one of the largest repositories for virtual screening of drug-like molecules.
PubChem CID: a unique identifier for substances in the PubChem database.
CAS number: a global registry number for chemical substances.
| ZINC ID | Name | CAS | Pubchem CID | Structure |
|---|---|---|---|---|
| ZINC1532336 | Chloramphenicol | 56-75-7 | 5959 | |
| ZINC11616717 | 4-[(2R,3S)-2-[(2,2-dichloroacetyl)amino]-3-hydroxy-3-(4-nitrophenyl)propoxy]-4-oxobutanoic acid | NA | 92402792 | |
| ZINC4535930 | PD054003 | NA | 45006058 | |
| ZINC4654660 | 4-[(2S,3R)-2-[(2,2-dichloroacetyl)amino]-3-hydroxy-3-(4-nitrophenyl)propoxy]-4-oxobutanoic acid | NA | 443384 |
References
[1] RNA aptamers to the peptidyl transferase inhibitor chloramphenicol.Burke, D. H., Hoffman, D. C., Brown, A., Hansen, M., Pardi, A., & Gold, L.
Chemistry & biology, 4(11), 833–843 (1997)
[2] In vitro selection and characterization of DNA aptamers recognizing chloramphenicol.
Mehta, J., Van Dorst, B., Rouah-Martin, E., Herrebout, W., Scippo, M. L., Blust, R., & Robbens, J.
Journal of biotechnology, 155(4), 361–369 (2011)