Description
Nishikawa, S. et al. reported aptamers with affinity for APC-167 in their article published in 1998. The APC-99 aptamer was named by Nishikawa, S. et al. in the article[1].
SELEX
In their work published in 1998, Nishikawa, S. et al. used SELEX to isolate RNA aptamer sequences with affinity for APC-167 from a nucleic acid library containing about 1013 sequences after 8 rounds of selection process. Protein-RNA complexes were filtered through a wet nitrocellulose filter in a pop-top filter holder, subsequently washed with 5 mL of binding buffer[1].
Structure
The 2D structure of the figure is based on the article by online secondary structure prediction tool to draw. The figure shows the secondary structure prediction of the original aptamer sequence. This aptamer contains three stem loops of different lengths and two complementary pairing areas, forming two three way junctions[1].
5'-GUGAGACCAGCCGAGUGGUGUCUGGCUAUUCACUGGAGCGUGGGUGGAACCCCUGCGCACUCGUUUGGCUGUCCGGGCCUUCGGGCCGGGAUUAUCUCU-3'
Ligand information
SELEX ligand
Human activated protein C (APC) is a vitamin K-dependent serine protease that regulates blood coagulation by inactivating factors Va and VIIIa in the presence of calcium ions and phospholipids. APC exerts a protective effect on the endothelial cell barrier function. Calcium also binds, with stronger affinity to another site, beyond the GLA domain. This GLA-independent binding site is necessary for the recognition of the thrombin-thrombomodulin complex.-----From Uniprot
UniProt ID: uniquely identifies protein sequences in the UniProt database, a resource for protein information.
Pfam: a widely recognised database of protein families and domains.
GenBank: maintained by NCBI(National Center for Biotechnology Information), is a database of nucleotide sequences from various organisms, vital for genetic and molecular biology research.
Mass: an intrinsic property of a body.
| Name | Uniprot ID | Pfam | Mass | Protein sequence | PDB ID | GenBank |
|---|---|---|---|---|---|---|
| APC | P04070 | PF00089 | 52.071 kDa |
......
MWQLTSLLLFVATWGISGTPAPLDSVFSSSERAHQVLRIRKRANSFLEELRHSSLERECIEEICDFEEAKEIFQNVDDTLAFWSKHVDGDQCLVLPLEHPCASLCCGHGTCIDGIGSFSCDCRSGWEGRFCQREVSFLNCSLDNGGCTHYCLEEVGWRRCSCAPGYKLGDDLLQCHPAVKFPCGRPWKRMEKKRSHLKRDTEDQEDQVDPRLIDGKMTRRGDSPWQVVLLDSKKKLACGAVLIHPSWVLTAAHCMDESKKLLVRLGEYDLRRWEKWELDLDIKEVFVHPNYSKSTTDNDIALLHLAQPATLSQTIVPICLPDSGLAERELNQAGQETLVTGWGYHSSREKEAKRNRTFVLNFIKIPVVPHNECSEVMSNMVSENMLCAGILGDRQDACEGDSGGPMVASFHGTWFLVGLVSWGEGCGLLHNYGVYTKVSRYLDWIHGHIRDKEAPQKSWAP
|
1AUT | 5624 |
Some isolated sequences bind to the affinity of the protein[1].
| Name | Sequence | Ligand | Affinity |
|---|---|---|---|
| APC-99 | 5'-GUGAGACCAGCCGAGUGGUGUCUGGCUAUUCACUGGAGCGUGGGUGGAACCCCUGCGCACUCGUUUGGCUGUCCGGGCCUUCGGGCCGGGAUUAUCUCU-3' | Human activated protein C | 120 nM |
| APC-167 | 5'-GGGAGAAUUCCGACCAGAAGCUUGUGAGACCAGCCGAGUGGUGUCUGGCUAUUCACUGGAGCGUGGGUGGAACCCCUGCGCACUCGUUUGGCUGUCCGGGCCUUCGGGCCGGGAUUAUCUCUUUGGGUUUUGUGAUUUGGUCAUAUGUGCGUCUACAUGGAUCCUCA-3' | Human activated protein C | 110 nM |
Similar compound(s)
We used the Dail server website to compare the structural similarities of ligand proteins, and chose the top 10 in terms of similarity for presentation.
| PDB | Z-socre | RMSD (Å) | Description |
|---|---|---|---|
| 5TO3-B | 35.8 | 1.4 | Prothrombin |
| 1Z8G-A | 33.1 | 1.5 | Serine protease hepsin |
| 7WQX-A | 32.7 | 1.7 | Enteropeptidase |
| 3H7T-A | 29.1 | 2.1 | Group 3 allergen smipp-S Yvt004a06 |
| 4A5T-S | 28.6 | 2.2 | Plasminogen |
| 4KKD-B | 28.5 | 2.2 | Mannan-binding lectin serine protease 1 |
| 5I25-A | 27.4 | 2.1 | Coagulation factor XI |
| 3H5C-B | 26.3 | 2.3 | Protein Z-dependent protease inhibitor |
| 2XXL-B | 24.9 | 2.2 | Gram-positive specific serine protease, isoform B |
| 2XRC-B | 24.0 | 1.8 | Human complement factor I |
References
[1] Selection of a RNA aptamer that binds to human activated protein C and inhibits its protease function.Gal, S. W., Amontov, S., Urvil, P. T., Vishnuvardhan, D., Nishikawa, F., Kumar, P. K., & Nishikawa, S.
European journal of biochemistry, 252(3), 553–562. (1998)