Two aptamers that recognize the fluorophore sulforhodamine B were isolated by the in vitro selection process[1]
Timeline
How SRB-2 RNA aptamer-fluorophore complexes can be simultaneously structurally and photophysically characterized by FCS was demonstrates[2]
An alternative approach based on contact quenching of fluorophores and fluorophore-binding aptamers (inculde SRB-2) to image RNA with small molecules in living cells was presented[3]
Combining contact-quenched fluorogenic probes with orthogonal DNB (the quencher-binding RNA aptamer) and SRB-2 aptamers allowed dual-colour imaging of two different fluorescence-enhancing RNA tags in living cells[4]
A novel, bright, orange fluorescent turn-on probe based on SBR-2 with low background fluorescence, enabling live-cell RNA imaging was rationally designed[5]
Description
In 1998, Wilson, C. et al. employed in vitro selection techniques to isolate aptamers with high-affinity binding sites for sulforhodamine B. The aptamer binds the fluorophore with high affinity, recognizing both the planar aromatic ring system and a negatively charged sulfonate, a rare example of anion recognition by RNA[1].
SELEX
SELEX was performed with a library containing ~5×1014 random RNA molecules and selected RNAs for their ability to bind Sulforhodamine agarose. After SELEX, researchers selected a number of sequences, including SRB-1 and SRB-2, to characterize their affinity for the dye and its spectral properties[1].
Structure
The 2D structure of the figure is based on the article by online secondary structure prediction tool to draw. The figure shows the secondary structure prediction of the original aptamer sequence. The secondary structure of SRB-2 aptamer is relatively complex. It contains four stem loops of different lengths connected through junctions. The longest complementary pairing region, which contains the terminal sequences of nucleic acid chains, constitutes the main part of the aptamer as part of the longest stem loop. In contrast, the structures of the other three stem loops are relatively simple. The SRB-2 aptamer was named by Wilson, C. et al. in the article[1].
SRB-2 aptamer:
5'-GGAACACUAUCCGACUGGCACCUGUGCUCUAUAGCAGAAUGCUAACAUUAGAUGAUGGAGGGGCGCAAGGUUAACCGCCUCAGUACAUCGGUGCCUUGGUCAUUAGGAUCCCG-3'
Following the SELEX procedure, the enriched nucleic acid library was subjected to high-throughput sequencing, generating a substantial population of raw sequence reads. The sequences presented herein represent additional high-affinity aptamers identified from this dataset[1].
Sulforhodamine B aptamer:
5'-GGAACCUCGCUUCGGCGAUGAUGGAGAGGCGCAAGGUUAACCGCCUCAGGUUCC-3'
SRB-2 aptamer:
5'-GGAACCUCGCUUCGGCGAUGAUGGAGAGGCGCAAGGUUAACCGCCUCAGGUUCC-3'
SRB-3 aptamer:
5'-GGAACCUUCGCUUCGGCGAUGAAGGAGAGGCGCAAGGUUAACCGCCUCAGGUUCC-3'
Ligand information
SELEX ligand
The Kd for sulforhodamine was determined both in solution and following immobilization on a solid support. The increase in fluorophore anisotropy, presumed to result from the change in rotational diffusion accompanying complex formation, may be accurately modeled using a simple hyperbolic function. The amount of aptamer bound as a function of ligand concentration (accessible packed bead concentration corrected for dilution) was fit by a non-linear least squares method using Kaliedagraph (Abelbeck Software) to a function of the form: % bound = f × [SR] / (KD + [SR]), where f is the fraction of RNA properly folded, [SR] is the accessible immobilized fluorophore concentration, and Kd is the dissociation constant for binding immobilized ligand[1].
| Ligand | Molecular Formula | MW | CAS | Solubility | PubChem CID | MCE Cat. No. | Sequence | Affinity |
|---|---|---|---|---|---|---|---|---|
| Sulforhodamine B | C27H30N2O7S2 | 558.7 g/mol | 2609-88-3 | 50 mg/mL in H2O, 62.5 mg/mL in DMSO | 65191 | HY-D0974 | 5'-GGAACACUAUCCGACUGGCACCUGUGCUCUAUAGCAGAAUGCUAACAUUAGAUGAUGGAGGGGCGCAAGGUUAACCGCCUCAGUACAUCGGUGCCUUGGUCAUUAGGAUCCCG-3' | 310 ± 60 nM |
Structure ligand
Sulforhodamine B (SRB) is often used as a membrane-impermeable polar tracer or used for cell density determination via determination of cellular proteins (cytotoxicity assay). The SRB assay has been used to inexpensively conduct various screening assays to investigate cytotoxicity in cell based studies. This method relies on the property of SRB, which binds stoichiometrically to proteins under mild acidic conditions and then can be extracted using basic conditions; thus, the amount of bound dye can be used as a proxy for cell mass, which can then be extrapolated to measure cell proliferation.-----From MedChemExpress
PubChem CID: a unique identifier for substances in the PubChem database.
CAS number: a global registry number for chemical substances.
MedChemExpress: an entry number for the classification of chemicals by the well-known chemical manufacturing company MedChemExpress.
| Name | Molecular Formula | Molecular Weight | CAS | Solubility | PubChem | MedChemExpress |
|---|---|---|---|---|---|---|
| Sulforhodamine B | C27H30N2O7S2 | 558.7 g/mol | 2609-88-3 | 50 mg/mL in H2O, 62.5 mg/mL in DMSO | 65191 | HY-D0974 |
Similar compound(s)
We screened the compounds with great similarity by using the ZINC database and showed some of the compounds' structure diagrams. For some CAS numbers not available, we will supplement them with Pubchem CID.
ZINC ID: a compound identifier used by the ZINC database, one of the largest repositories for virtual screening of drug-like molecules.
PubChem CID: a unique identifier for substances in the PubChem database.
CAS number: a global registry number for chemical substances.
| ZINC ID | Name | CAS | Pubchem CID | Structure |
|---|---|---|---|---|
| ZINC4235524 | Sulforhodamine B | 2609-88-3 | 65191 | |
| ZINC95713114 | Xanthylium | 62796-29-6 | 65224 | |
| ZINC3874033 | [4-[[4-(diethylamino)phenyl]-(2,4-disulfophenyl)methylidene]cyclohexa-2,5-dien-1-ylidene]-diethylazanium | 129-17-9 | 8508 | |
| ZINC4365621 | Carmine Blue V/Solar Pure Blue VX | 20262-76-4 | 77074 | |
| ZINC80902125 | (4-(3,6-Bis(diethylamino)-9H-xanthen-9-yl)benzene-1,3-disulphonic acid) | 85681-99-8 | 3020898 |
References
[1] Isolation and characterization of fluorophore-binding RNA aptamers.Holeman, L. A., Robinson, S. L., Szostak, J. W., & Wilson, C.
Folding & design, 3(6), 423–431. (1998)
[2] Characterization of a fluorophore binding RNA aptamer by fluorescence correlation spectroscopy and small angle X-ray scattering.
Werner, A., Konarev, P. V., Svergun, D. I., & Hahn, U.
Analytical biochemistry, 389(1), 52–62. (2009)
[3] Contact-Mediated Quenching for RNA Imaging in Bacteria with a Fluorophore-Binding Aptamer.
Sunbul, M., & Jäschke, A.
Angewandte Chemie, 52(50), 13401–13404. (2013)
[4] Dual-colour imaging of RNAs using quencher- and fluorophore-binding aptamers.
Arora, A., Sunbul, M., & Jäschke, A.
Nucleic acids research, 43(21), e144. (2015)
[5] SRB-2: a promiscuous rainbow aptamer for live-cell RNA imaging.
Sunbul, M., & Jäschke, A.
Nucleic acids research, 46(18), e110. (2018)
[6] A dimerization-based fluorogenic dye aptamer module for RNA imaging in live cells.
Bouhedda, F., Fam, K. T., Collot, M., Autour, A., Marzi, S., Klymchenko, A., & Ryckelynck, M.
Nature chemical biology, 16(1), 69–76. (2020)