Description
In 2000,G P Tocchini-Valentini et al. screened in vitro for RNA aptamers that specifically bind the free amino acid tyrosine from a degraded pool derived from dopamine aptamers and used these aptamers to study their highly L-stereoselective binding properties to tyrosine and its related ligands[1].
SELEX
G P Tocchini-Valentini et al. obtained Tyr 1 aptamer by in vitro selection and amplification from a partially randomized RNA pool of the dopamine aptamer dopa2/c+1. After 13 rounds of screening, six unique sequences were identified from 63 clones, among which Tyr 1 showed the highest L-tyrosine binding affinity, which was determined by isothermal ligand elution with a dissociation constant (Kd) of 35 μM[1].
Structure
The sequence and secondary prediction structure of the aptamer will be shown here, here we used ribodraw to complete the figure. The 2D structure of the figures is based on the prediction results of the RNA fold website by ribodraw tool to draw. We used the minimum free energy (MFE) structure. Try1 aptamer binding to L-tyrosine.
5'-GGGAAGCUUGUACAGGGGGCAGUCAACUCGUGCGAUCGUGAAAACGGGGCAAGAUGGCCUUACAGCGGUCAAUACGGGGGUCAUCAGAUAGGGAGGCCCUCCUGGUGGUCCGUUCGGGAUCCUC-3'
Ligand information
SELEX ligand
L-tyrosine is an optically active form of tyrosine having L-configuration. It has a role as an EC 1.3.1.43 (arogenate dehydrogenase) inhibitor, a nutraceutical, a micronutrient and a fundamental metabolite. It is an erythrose 4-phosphate/phosphoenolpyruvate family amino acid, a proteinogenic amino acid, a tyrosine and a L-alpha-amino acid. It is functionally related to a L-tyrosinal. It is a conjugate base of a L-tyrosinium. It is a conjugate acid of a L-tyrosinate(1-). It is an enantiomer of a D-tyrosine. It is a tautomer of a L-tyrosine zwitterion.-----From ChEBI| Name | Molecular Formula | MW | CAS | Solubility | PubChem | Drug ID |
|---|---|---|---|---|---|---|
| L-tyrosine | C9H11NO3 | 181.19 g/mol | 60-18-4 | 0.45 g/L (25 ℃) | 6057 | DB00135 |
Similar compound
We used the PubChem database to screen compounds that were more similar to L-tyrosine, and selected the most similar compounds for display. For those without CAS numbers, we will supplement them with Pubchem CID.
| Named | CAS | Pubchem CID | Structure |
|---|---|---|---|
| Levodopa | 59-92-7 | 6047 | |
| Metyrosine | 672-87-7 | 441350 | |
| DL-Dopa | 63-84-3 | 836 | |
| 3,5-Diiodo-L-tyrosine | 300-39-0 | 9305 | |
| Racemetirosine | 658-48-0 | 3125 | |
| 3-Iodo-L-tyrosine | 70-78-0 | 439744 |
References
[1] Molecular recognition of amino acids by RNA aptamers: the evolution into an L-tyrosine binder of a dopamine-binding RNA motif.Mannironi C, Scerch C, Fruscoloni P, Tocchini-Valentini GP
RNA. 2000 Apr;6(4):520-7. (2000)
[2] NA aptamers-in-droplets (RAPID) high-throughput screening for secretory phenotypes.
Abatemarco J, Sarhan MF, Wagner JM, Lin JL, Liu L, Hassouneh W, Yuan SF, Alper HS, Abate AR
Nature communications. 2017 Aug 23;8(1):332. (2017)