Hwang B et al. libraries containing extra random nucleotides extended to the 3′ end of previously selected RNA sequences[2]
Timeline
Description
In 2003, Hwang B and Han K had used the methodology which is in vitro transcription of synthetic DNA templates, radiolabeled, and isolated as described to select RNA aptamers against mAb198 . The aptamers, tMG RNA , binds with high affinity to specifically recognize mAb198[1].
SELEX
In 2003, Hwang B and Han K selected RNA aptamer by the methodology that full-length RNA aptamer with 2P-deoxy-2P-£uoropyrimidines (Ambion) previously selected against mAb198 or its truncated form (fMG RNA or tMG RNA, respectively) was synthesized by in vitro transcription of synthetic DNA templates, radiolabeled, and isolated[1].
Structure
The 2D structure of the figure is based on the article by ribodraw tool to draw[1].
5'GGGCCGGAGGUUAGCUUGCCCAUGGCAAGCAGGGCGCCACGGACCC3'
Ligand information
SELEX ligand
Clinical symptoms of EAMG in rats engendered by passive transfer of mAb198.-----from paper
| Name | Uniprot ID | Pfam | MW | Amino acids sequences | PDB | Gene ID |
|---|---|---|---|---|---|---|
| mAb198(rat monoclonal antibody) | NA | NA | 1.88 kDa | PMTLPENYFSERPYH | 2JRV | 2JRV_A |
The aptamer bind to the affinity of the protein.
| Name | Sequence | Ligand | Affinity |
|---|---|---|---|
| tMG RNA | 5'GGGCCGGAGGUUAGCUUGCCCAUGGCAAGCAGGGCGCCACGGACCC3' | mAb198(rat monoclonal antibody) | 30 nM |
References
[1] Prevention of passively transferred experimental autoimmune myasthenia gravis by an in vitro selected RNA aptamer.Hwang B, Han K, Lee SW.
FEBS Lett. 548(1-3):85-9. (2003)
[2] Improvement of RNA aptamer activity against myasthenic autoantibodies by extended sequence selection.
Hwang B, Lee SW.
Biochem Biophys Res Commun. 290(2):656-62. (2002)